Order For Custom Writing, Similar Answers & Assignment Help Services

Fill the order form details in 3 easy steps - paper's instructions guide.

Posted: September 18th, 2022

K-mers & Markov Chains

Q1: For this sequence: ATTACCAGAGACGATTACG

K-mers & Markov Chains

Q1: For this sequence: ATTACCAGAGACGATTACG

(a) List all of the k-mers (size 3) you can derive
(b) For each k-mer, list how many times it appears in the sequence
(c) Given the information above, how many unique k-mers (size 3) are there in this sequence?

Q2: Given the following matrix showing empirically-determined mutation frequencies:

A T C G
A 0.9 0.004 0.03 0.05
T 0.015 0.9 0.02 0.02
C 0.015 0.02 0.9 0.005
G 0.07 0.004 0.05 0.9

(a) Draw the digraph (directed graph) showing the possible state transitions, with accompanying frequencies

—-

Markov Chains and K-mers

Q1: ATTACCAGAGACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATT
a

(a) Compile a list of all the k-mers (size 3) from which you can derive

(b) For each k-mer, count the number of times it appears in the sequence.

(c) Given the aforementioned information, how many distinct k-mers (size 3) are there in this sequence?

Q2: Given the matrix below, which shows empirically determined mutation frequencies:

A T C G

A 0.9 0.004 0.03 0.05

T 0.015 0.9 0.02 0.02

C 0.015 0.02 0.9 0.005

G 0.07 0.004 0.05 0.9

(a) Create a digraph (directed graph) depicting the possible state transitions and their corresponding frequencies.

Order | Check Discount

Tags: best assignment help websites in canada, best nursing paper writing service, buy psychology essay, Cheap Psychology Essay Writing Service, dissertation assignment help

Assignment Help For You!

Special Offer! Get 15-30% Off on Each Order!

Why Seek Our Custom Writing Services

Every Student Wants Quality and That’s What We Deliver

Graduate Essay Writers

Only the most qualified writers are selected to be a part of our research and editorial team, with each possessing specialized knowledge in specific subjects and a background in academic writing.

Affordable Prices

Our prices strike the perfect balance between affordability and quality. We offer student-friendly rates that are competitive within the industry, without compromising on our high writing service standards.

100% Plagiarism-Free

No AI/chatgpt use. We write all our papers from scratch thus 0% similarity index. We scan every final draft before submitting it to a customer.

How it works

When you decide to place an order with Nursing.StudyBay, here is what happens:

Fill the Order Form

You will complete our order form, filling in all of the fields and giving us as much guidelines - instruction details as possible.

Assignment of Writer

We assess your order and pair it with a skilled writer who possesses the specific qualifications for that subject. They then start the research/writing from scratch.

Order in Progress and Delivery

You and the assigned expert writer have direct communication throughout the process. Upon receiving the final draft, you can either approve it or request revisions.

Giving us Feedback (and other options)

We seek to understand your experience. You can also review testimonials from other clients, from where you can select your preferred professional writer to assist with your homework assignments.

Expert paper writers are just a few clicks away

Place an order in 3 easy steps. Takes less than 5 mins.

Calculate the price of your order

You will get a personal manager and a discount.
We'll send you the first draft for approval by at
Total price:
$0.00