Graduate Essay Writers
Only the most qualified writers are selected to be a part of our research and editorial team, with each possessing specialized knowledge in specific subjects and a background in academic writing.
To hire a writer, fill the order form with details from your nursing assessment task brief—assignment instructions.
Posted: January 26th, 2023
Take a look at Extended Data Figure 3 from Huerta-Sánchez et al (2014). How does this figure emphasize that the Tibetan allele for EPAS1 came from Denisovans? (10 points)
2. You are given the following seven aligned sequences from a single population (variants with respect to the first sequence are shown in bold). Justify whether or not you see any evidence of selection. (20 points)
TGGAGTGTGACCATAGCGAT
TGGAGTTTGACCATAGCCAT
TGGAGTGTGACCATAACCAT
TGGTGTTTGCCCATAACGAT
TGGTGTGTGACCATAGCGAT
TGGTGTGTGCCCATAGCGAT
TGGAGTGTGACCATAACGAT
3. Explain the concept of the “Neutral Theory of Molecular Evolution” and how it relates to the idea of a molecular clock? (10 points)
Extended Data Figure 3 from Huerta-Sánchez et al (2014) shows the distribution of alleles for the gene EPAS1 in various populations. The figure emphasizes that the Tibetan allele for EPAS1 came from Denisovans by showing that this particular allele is found only in Tibetans and Denisovans, and not in any other populations studied. This suggests that the allele was introduced into the Tibetan population through interbreeding with Denisovans.
The seven aligned sequences show evidence of genetic variation within the population, but it is not possible to determine if there is evidence of selection based on this limited data. To determine if selection is occurring, additional information is needed, such as the functional significance of the alleles, the frequency of the alleles in the population, and whether the alleles are associated with any particular traits.
The Neutral Theory of Molecular Evolution posits that most evolutionary changes at the molecular level, such as changes in DNA sequences, are due to neutral processes such as genetic drift and mutation, rather than natural selection. The concept of a molecular clock refers to the idea that the rate of accumulation of mutations in DNA sequences is roughly constant over time, allowing the estimation of evolutionary divergence times between species based on the number of differences in their DNA sequences. The Neutral Theory suggests that this molecular clock reflects the accumulation of neutral mutations, which are not subject to natural selection and therefore evolve randomly over time.
Tags: write my dissertation for me, write dissertation paper, write dissertation for me, help me write my dissertation, do my dissertation for meEvery Student Wants Quality and That’s What We Deliver
Only the most qualified writers are selected to be a part of our research and editorial team, with each possessing specialized knowledge in specific subjects and a background in academic writing.
Our prices strike the perfect balance between affordability and quality. We offer student-friendly rates that are competitive within the industry, without compromising on our high writing service standards.
No AI/chatgpt use. We write all our papers from scratch thus 0% similarity index. We scan every final draft before submitting it to a customer.
When you decide to place an order with Nursing Study Bay, here is what happens:
Find an expert by filling an order form for your nursing paper. We write AI-plagiarism free essays and case study analysis. Anytime!