Posted: September 18th, 2022

K-mers & Markov Chains

Q1: For this sequence: ATTACCAGAGACGATTACG

K-mers & Markov Chains

Q1: For this sequence: ATTACCAGAGACGATTACG

(a) List all of the k-mers (size 3) you can derive
(b) For each k-mer, list how many times it appears in the sequence
(c) Given the information above, how many unique k-mers (size 3) are there in this sequence?

Q2: Given the following matrix showing empirically-determined mutation frequencies:

A T C G
A 0.9 0.004 0.03 0.05
T 0.015 0.9 0.02 0.02
C 0.015 0.02 0.9 0.005
G 0.07 0.004 0.05 0.9

(a) Draw the digraph (directed graph) showing the possible state transitions, with accompanying frequencies

—-

Markov Chains and K-mers

Q1: ATTACCAGAGACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATT
a

(a) Compile a list of all the k-mers (size 3) from which you can derive

(b) For each k-mer, count the number of times it appears in the sequence.

(c) Given the aforementioned information, how many distinct k-mers (size 3) are there in this sequence?

Q2: Given the matrix below, which shows empirically determined mutation frequencies:

A T C G

A 0.9 0.004 0.03 0.05

T 0.015 0.9 0.02 0.02

C 0.015 0.02 0.9 0.005

G 0.07 0.004 0.05 0.9

(a) Create a digraph (directed graph) depicting the possible state transitions and their corresponding frequencies.

Order | Check Discount

Tags: best assignment help websites in canada, best nursing paper writing service, buy psychology essay, Cheap Psychology Essay Writing Service, dissertation assignment help