Graduate Essay Writers
Only the most qualified writers are selected to be a part of our research and editorial team, with each possessing specialized knowledge in specific subjects and a background in academic writing.
To hire a writer, fill the order form in a few guided steps - with details from your paper's instructions.
Posted: September 18th, 2022
Q1: For this sequence: ATTACCAGAGACGATTACG
K-mers & Markov Chains
Q1: For this sequence: ATTACCAGAGACGATTACG
(a) List all of the k-mers (size 3) you can derive
(b) For each k-mer, list how many times it appears in the sequence
(c) Given the information above, how many unique k-mers (size 3) are there in this sequence?
Q2: Given the following matrix showing empirically-determined mutation frequencies:
A T C G
A 0.9 0.004 0.03 0.05
T 0.015 0.9 0.02 0.02
C 0.015 0.02 0.9 0.005
G 0.07 0.004 0.05 0.9
(a) Draw the digraph (directed graph) showing the possible state transitions, with accompanying frequencies
—-
Markov Chains and K-mers
Q1: ATTACCAGAGACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATT
a
(a) Compile a list of all the k-mers (size 3) from which you can derive
(b) For each k-mer, count the number of times it appears in the sequence.
(c) Given the aforementioned information, how many distinct k-mers (size 3) are there in this sequence?
Q2: Given the matrix below, which shows empirically determined mutation frequencies:
A T C G
A 0.9 0.004 0.03 0.05
T 0.015 0.9 0.02 0.02
C 0.015 0.02 0.9 0.005
G 0.07 0.004 0.05 0.9
(a) Create a digraph (directed graph) depicting the possible state transitions and their corresponding frequencies.
Tags: best assignment help websites in canada, best nursing paper writing service, buy psychology essay, Cheap Psychology Essay Writing Service, dissertation assignment helpEvery Student Wants Quality and That’s What We Deliver
Only the most qualified writers are selected to be a part of our research and editorial team, with each possessing specialized knowledge in specific subjects and a background in academic writing.
Our prices strike the perfect balance between affordability and quality. We offer student-friendly rates that are competitive within the industry, without compromising on our high writing service standards.
No AI/chatgpt use. We write all our papers from scratch thus 0% similarity index. We scan every final draft before submitting it to a customer.
When you decide to place an order with Nursing Study Bay, here is what happens:
Find an expert with a few clicks and guided steps, fill an order form for your nursing paper. We write AI-plagiarism free essays and research papers. Anytime!.